View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_135 (Length: 310)
Name: NF10865A_low_135
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_135 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 37012706 - 37012982
Alignment:
| Q |
16 |
acaaatcacttaggaaattactcaagccacaaatgtgtgtctttttattctatcccacttgtgcttcatgctttggaggacaagtatatatttaaaggaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
37012706 |
acaaatcacttaggaaattactcaagccacaaatgtgtgtctttttattctatcccacttgtgcttcatgctttggaggacaagtacatatttaa-ggaa |
37012804 |
T |
|
| Q |
116 |
aaaacaaaatcatggttggttggcgtggtcttatggacaattgggattctatgcatattccttgtattcacttggtagtgttaattgttaaattaaagac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37012805 |
aaaacaaaatcatggttggttggcgtggtcttatggacaattgggattctatgcatattccttgtattcacttggtagtgttaattgttaaattaaagac |
37012904 |
T |
|
| Q |
216 |
tagacgacttgaaattttgagtttcaaagaaaaattaatttattaagtttaattgtttaaagtcactttgaatgtgtg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37012905 |
tagacgacttgaaattttgagtttcaaagaaaaattaatttattaagtttaattgtttaaagtcactttgaatgtgtg |
37012982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University