View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_148 (Length: 295)
Name: NF10865A_low_148
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_148 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 39 - 164
Target Start/End: Original strand, 41224296 - 41224421
Alignment:
| Q |
39 |
gatcctctctcatgctgnnnnnnntgtgagaaaataatgtggaatatctagatgattgaaatatagaggggaaggttttgaaatttgaaataataaagga |
138 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41224296 |
gatcctctctcatgctgaaaaaaatgtgagaaaaaaatgtggaatatctagatgattgaaatatagaggggaaggttttgaaatttgaaataataaagga |
41224395 |
T |
|
| Q |
139 |
gaaacactagttaaggattgagattt |
164 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41224396 |
gaaacactagttaaggattgagattt |
41224421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 156 - 280
Target Start/End: Original strand, 41224447 - 41224571
Alignment:
| Q |
156 |
ttgagatttgaaacttgagaaaataggaggagaaatagcgatgattcacttcttgttgttgggcacaaatggagtgatggtaannnnnnngcttacctag |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41224447 |
ttgagatttgaaacttgagaaaataggaggagaaatagcgacgattcacttcttgttgttgggcacaaatggagtgatggtaatttttttgcttacctag |
41224546 |
T |
|
| Q |
256 |
ttaatttatttgatatcatcataat |
280 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41224547 |
ttaatttatttgatatcatcataat |
41224571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University