View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_162 (Length: 287)
Name: NF10865A_low_162
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_162 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0002 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 7 - 287
Target Start/End: Original strand, 336929 - 337209
Alignment:
| Q |
7 |
ggaagttccaatagtcatgcatccccaacaagtgcagcgagcattccacgatctccttcttccaactctaatcaacaacttcttgctcaaaggaaattgt |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336929 |
ggaagttccaatagtcatgcatctccaacaagtgcagcgagcattccacgatctccttcttccaactctaatcaacaacttcttgctcaaaggaaattgt |
337028 |
T |
|
| Q |
107 |
ttgcagaatcccaaataggaagatccagttttcagaagcttttggagccaaaactccctcatcttcctggaattgctccttatagaattgtcctcgggaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
337029 |
ttgcagaatcccaaataggaagatccagttttcagaagcttttggagccaaaactccctcatcttcctggaattgctccttatagaattgtccttgggaa |
337128 |
T |
|
| Q |
207 |
tgtaaaagataaggtatcccttctgaattctgatctactctaataatatatgttaactggatctgcatgtatggacactag |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337129 |
tgtaaaagataaggtatcccttctgaattctgatctactctaataatatatgttaactggatctgcatgtatggacactag |
337209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 130 - 223
Target Start/End: Original strand, 42172507 - 42172600
Alignment:
| Q |
130 |
tccagttttcagaagcttttggagccaaaactccctcatcttcctggaattgctccttatagaattgtcctcgggaatgtaaaagataaggtat |
223 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||| |||||||||||||||||||||||| ||||||| || |||||||| |||||||||| |
|
|
| T |
42172507 |
tccagttttcagaaacttttggagccacagctccctcaacttcctggaattgctccttatagagttgtcctgggaaatgtaaaggataaggtat |
42172600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University