View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_167 (Length: 284)
Name: NF10865A_low_167
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_167 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 278
Target Start/End: Complemental strand, 37726333 - 37726066
Alignment:
| Q |
11 |
gtgttgattgggttttcttgcagctcctaattagctagtttttaggtgtcagtgtttctagtactaggaaaatcttaatactaagacacctgaataatga |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37726333 |
gtgttgatacggttttcttgcagctcctaattagctagtttttaggtgtcagtgtttctagtactaggaaaatcttaatactaagacacctgaatgatga |
37726234 |
T |
 |
| Q |
111 |
agtctttatatgaaggacacaattttctgctgtcaaggtgatttcgaaatgaacaagtcagtcaaagttgatttacttgggtaacaagtgtaatcttgta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37726233 |
agtctttatatgaaggacacaattttctgctgtcaaggtgatttcgaaataaacaagtcagccaaagttgatttacttgggtaacaagtgtaatcttgta |
37726134 |
T |
 |
| Q |
211 |
agtaagttgtctatttagatactctagttaacatcctaggtggcagtagagtgttttatggtttaagt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37726133 |
agtaagttgtctatttagatactctagttaacatcctaggtggcagtagagtgttttatggtttaagt |
37726066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University