View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_171 (Length: 280)
Name: NF10865A_low_171
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_171 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 139 - 280
Target Start/End: Complemental strand, 32907519 - 32907376
Alignment:
| Q |
139 |
gacagaaaatacaaaagagaggagtgaatagggaagccaacaattctgctgatttgctaaccaagagaggagtgacaattaatgggaggattattgagtg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32907519 |
gacagaaaatacaaaagagaggagtgaacagggaagccaacaattctgctgatttgctaaccaagagaggagtgacaattagtgggaggattattgagtg |
32907420 |
T |
|
| Q |
239 |
gttcacacataatatagg--ataaagtgagagtattttgtcagg |
280 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32907419 |
gttcatacataatataggatataaagtgagagtattttgtcagg |
32907376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 32907697 - 32907580
Alignment:
| Q |
8 |
agatttcaatagtgtaaagccagtagtatttcattacagttacctggaagcaaatccatccaatggcagaataccctccatataaggtttaatatattaa |
107 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
32907697 |
agatttcgatagtataaagccagtagtatttcattacaattacctggaagcaaatccatccaatggaagaataccctccatataaagtttaatacattaa |
32907598 |
T |
|
| Q |
108 |
gttttaagacatgctaca |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32907597 |
gttttaagacatgctaca |
32907580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University