View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_178 (Length: 278)
Name: NF10865A_low_178
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_178 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 12 - 272
Target Start/End: Original strand, 38643184 - 38643444
Alignment:
| Q |
12 |
atgaaatagtgagtagtagtactttagtaattcaacagaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatcctac |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643184 |
atgaaatagtgagtagtagtattttagtaattcaacaaaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatcctac |
38643283 |
T |
|
| Q |
112 |
attctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcaccccaagaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643284 |
attctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcaccccaagaat |
38643383 |
T |
|
| Q |
212 |
aatggaacatagaagaaactcatcatggtttcttctattctcaactctttcttgtcttttt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643384 |
aatggaacatagaagaaactcatcatggtttcttctattctcaactctttcttgtcttttt |
38643444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University