View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_179 (Length: 278)
Name: NF10865A_low_179
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_179 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 28734897 - 28734639
Alignment:
| Q |
14 |
agatatttccaaagcaaacatcaagctttgaccaccttattcaacactgattgctgaggtcaagctcggtcatagcttaattttggtcaatggtgcttca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28734897 |
agatatttccaaagcaaacatcaagctttgaccaccttattcaacactgattgctgaggtcaagctcagtcatagcttaattttggtcaatggtgcttca |
28734798 |
T |
|
| Q |
114 |
gctatgcaggactacaaaatctctcaactgtttcacatccctctcaaatctaaaagggtcagtcccttcactgaagttgcttggaaacctcctagcggtg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
28734797 |
gctatgcaggactacaaaatctctcaactgtttcacatccctctcaaatctaaaagggtcagtcccttcactgaaattgcttggaaacctactagcggtg |
28734698 |
T |
|
| Q |
214 |
gaactattaagttcaattgtgatgaatcttctataggggctcacccttgtggggccatt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28734697 |
gaactattaagttcaattgtgatgaatcttctataggggctcacccttgtggggccatt |
28734639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 272
Target Start/End: Complemental strand, 8634570 - 8634481
Alignment:
| Q |
183 |
actgaagttgcttggaaacctcctagcggtggaactattaagttcaattgtgatgaatcttctataggggctcacccttgtggggccatt |
272 |
Q |
| |
|
||||||||| |||||| ||||||| ||||| ||| | |||||||||||||||| ||||||| | ||||| ||||||||||| |||||| |
|
|
| T |
8634570 |
actgaagttacttggattcctcctacaggtggtactgtcaagttcaattgtgatggatcttctgttggggcacacccttgtggtgccatt |
8634481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University