View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_240 (Length: 252)
Name: NF10865A_low_240
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_240 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 6 - 104
Target Start/End: Complemental strand, 30103174 - 30103076
Alignment:
| Q |
6 |
agtaccttttttcttggcatataccattaggtgaatttgagagggaaaacgatggtggaggagttgttcttctggaagggaagcaacaacccaaaccca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30103174 |
agtaccttttttcttggcatataccattaggtgaatttgagagggaaaacgatggtggaggagttgttcttctggaagggaagcaacaacccaaaccca |
30103076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 179 - 245
Target Start/End: Complemental strand, 30102991 - 30102925
Alignment:
| Q |
179 |
atacaattttacttgtctgaatttttgttgttaaatcaatcttatgaataaatattgatatttttcg |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30102991 |
atacaattttacttgtttgaatttttgttgttaaatcaatcttatgaataaatattgatattgttcg |
30102925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University