View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_256 (Length: 250)
Name: NF10865A_low_256
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_256 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 33262239 - 33262054
Alignment:
| Q |
17 |
tgaatgacccaaaatcattgagctcagctcttcttaagttgggatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaacta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33262239 |
tgaatgacccaaaatcattgagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaacta |
33262140 |
T |
|
| Q |
117 |
gtcattgttgacccctccaatatggcagtttgtggttgcagatgactaattgctggcccttccaacatggcactccgtggttgcaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| || ||||| |||| |
|
|
| T |
33262139 |
gtcattgttgacccctccaatatggcagttcgtggttgcagattactaattgatggcccttccaacatggcagtctgtggtagcaa |
33262054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 33262025 - 33261971
Alignment:
| Q |
186 |
gcactccgtggttgcaactcagtcatcgctggcccttgcaatatcgctctctgtg |
240 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262025 |
gcactctgtggttccaactcagtcatcgctggcccttgcaatatcgctctctgtg |
33261971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University