View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_258 (Length: 250)
Name: NF10865A_low_258
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_258 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 9868070 - 9867839
Alignment:
| Q |
19 |
acatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctctttgatcatgatttcgtc |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9868070 |
acatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctctttgatcatgatttcgcc |
9867971 |
T |
|
| Q |
119 |
atgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataacacttttctagacagtgtgatccaattaccac |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
9867970 |
atgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatggtgtgatccaattaccac |
9867871 |
T |
|
| Q |
219 |
taagatcgctactaaaggcaaaccacaatcga |
250 |
Q |
| |
|
|| |||||||||||||||||||||||| |||| |
|
|
| T |
9867870 |
tacgatcgctactaaaggcaaaccacagtcga |
9867839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University