View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_271 (Length: 249)
Name: NF10865A_low_271
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_271 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 30411014 - 30411230
Alignment:
| Q |
11 |
cagagaacagtgctaatgatgatgaacaagcagtcctgcaacaagatatctagttcttaaaagagtcatggtccaaccttgttgagatggagccaatgat |
110 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30411014 |
cagaaaacagtgctaatgatgatgatcaagcagtcctgcaacaagatatctagttcttaaaagagtcatggtccaaccttgttgagatgaagccaatgat |
30411113 |
T |
 |
| Q |
111 |
ggtgactttgaacaagatctcaatgctgtcaagtaacaggtcaggaggtaaatacagctagaaacttgattggtaagttacctgcagaaacatctttttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30411114 |
ggtgactttgaacaagatctcaatgctgtcaa--tacaggtcaggaggcaaatacatctagaaacttgattggtaagttacctgcagaaacatctttgtc |
30411211 |
T |
 |
| Q |
211 |
caaagaagcagatgctctt |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30411212 |
caaagaagcagatgctctt |
30411230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University