View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_274 (Length: 248)
Name: NF10865A_low_274
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_274 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 49086584 - 49086355
Alignment:
| Q |
19 |
agaagggacaatggaatgaaggagacgtggcttagatcgagtcgtttcaccgacatttggataaacttatagacttataaaaccaacagtttctgcattc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49086584 |
agaagggacaatggaatgaaggagacgtggcttagatcgggtcgtttcaccgacatttggataaacttatagacttataaaaccaacagtttctgcatgc |
49086485 |
T |
 |
| Q |
119 |
aatgaaaattggtttgctcactattgattatgtgtgtttagtatagttctacacatgtttggttctcatgcttcgacagatcccacaacacgtcacattc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49086484 |
aatgaaaattggtttgctcactattgattatgtgtgtttagtatagttctacacatgtttggttctcatgcttcgccagatcccacaacacgtcacattc |
49086385 |
T |
 |
| Q |
219 |
aatttttacaccatttatttatttgcaaag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49086384 |
aatttttacaccatttatttatttgcaaag |
49086355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University