View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_276 (Length: 247)
Name: NF10865A_low_276
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_276 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 41224089 - 41223868
Alignment:
| Q |
5 |
tagcaaaagttgcactattgcactaaccaatcaaatccataaatttagcaagtgtgctatgttattcctcacaggcttcattgcaacttcattgaccatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41224089 |
tagcaaaagttgcactattgcactaaccaatcaaatccataaatttagcaagtgtgctatgttattcctcacaggcttcattgcaacttcattgaccatc |
41223990 |
T |
|
| Q |
105 |
tctagtgtggtcttcactgagtcatcaatattttcagccaaatgctctaacatgtagtatatataattagcaatacagtcactacactcaacattgacat |
204 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41223989 |
tctagtgcggtcttcaccgagtcatcaatattttcagccaaatgctctaacatgtagtatatataattagcaatacagtcactacattcaacattgacat |
41223890 |
T |
|
| Q |
205 |
caacacgatactaagttgaatc |
226 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
41223889 |
caacacgacactaagttgaatc |
41223868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University