View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_284 (Length: 246)
Name: NF10865A_low_284
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_284 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 43703074 - 43703304
Alignment:
| Q |
16 |
acatcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcgctacaaagtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43703074 |
acatcaacagttacacttatgcagagaaatttacaccaaagtttcatgttagacttgctttttgagcaaaataaaacatactttatttcactacaaagtt |
43703173 |
T |
|
| Q |
116 |
taaacttggttttattcacattacttttatcaccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaattt |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703174 |
taaactttgttttattcacattacttttatcgccaacatgagttggtccgacttgaaggggctcggatcccttgagcaagaggtataggattcaaaattt |
43703273 |
T |
|
| Q |
216 |
agtttttgtgaatcaagcaaattctgttggg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43703274 |
agtttttgtgaatcaagcaaattctgttggg |
43703304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University