View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_286 (Length: 245)
Name: NF10865A_low_286
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_286 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 40411917 - 40412141
Alignment:
| Q |
21 |
agtctcttcaaatggaaatttaacatctaatcactcttttctatacaattccaccacacaaaataaaatataaaagcaaccacaaaactaaaggatatta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40411917 |
agtctcttcaaatggaaatttaacatctaatcactctcttctatacaattccaccacacaaaataaaatataaaagcaaccacaaaactaaaggatatta |
40412016 |
T |
 |
| Q |
121 |
ggggaaaagaagaataaggaccattttgttctgtatcccatgaatatttgaacaaaatgagttggctcagccagcaatgatcaattcaaagcacaccact |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40412017 |
ggggaaaagaagaataaggaccattttgttctgtatcccatgaatatttgaacaaaatgagttggctcagccagcaatgatcaattcaaagcacaccact |
40412116 |
T |
 |
| Q |
221 |
tgtaaggcagggtttgattgccact |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40412117 |
tgtaaggcagggtttgattgccact |
40412141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University