View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_287 (Length: 245)
Name: NF10865A_low_287
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_287 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 34468834 - 34469053
Alignment:
| Q |
5 |
taccagcaatattgttcactgtttgcagcgtcttcaattttgaatcttcctattctatatataaataatatattgcttcttagctacagcagtatggtaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34468834 |
taccagcaatattgttcactgtttgcagcgtcttcaattttgaatcttcctattctatatataaataatatattgcttcttagctacagcagtatggtaa |
34468933 |
T |
|
| Q |
105 |
gaaggtcagtgatacaataatctggttgtgtactttcagaactgaggtgttagatatttgtgtaaactggatacttcctttgcaattgccatgttaagat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
34468934 |
gaaggtcagtgatacaataatctggttgtgtactttcagaactgaggtgttagatatttgtgtaaactggatgcttcctttgcacttgccatgttaagat |
34469033 |
T |
|
| Q |
205 |
gtagaattggaccatggcgt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34469034 |
gtagaattggaccatggcgt |
34469053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University