View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_288 (Length: 245)
Name: NF10865A_low_288
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_288 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 199
Target Start/End: Original strand, 29583617 - 29583810
Alignment:
| Q |
6 |
catagaaagagtgtacatccctttttgcgaatgagttgagtgagtatcactataaacctagagatgccaaggatggaaaatctggagcataatccaagtg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583617 |
catagaaagagtgtacatccctttttgcgaatgagttgagtgagtatcactataaacctagagatgccaaggatggaaaatctggagcataatccaagtg |
29583716 |
T |
 |
| Q |
106 |
tcattacgaatgaactctaatattatcttaaattttggtttggacctaactcaacctcacaatatcggtttgtaaggtaagggatatttctcac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583717 |
tcattacgaatgaactctaatattatcttaaattttggtttggacctaactcaacctcacaatatcggtttgtaaggtaagggatatttctcac |
29583810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 245
Target Start/End: Original strand, 29583921 - 29583958
Alignment:
| Q |
208 |
aaagctgtagttaatcagcgtagcaaattcataagttg |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
29583921 |
aaagctgtagttaatcaacgtagcaaattcagaagttg |
29583958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 19809943 - 19809995
Alignment:
| Q |
131 |
tcttaaattttggtttggacctaactcaacctcacaatatcggtttgtaaggt |
183 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
19809943 |
tcttaaattttgggttgggcctaactcaaccttacaaaatcggcttgtaaggt |
19809995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University