View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_305 (Length: 243)
Name: NF10865A_low_305
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_305 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 24620951 - 24620719
Alignment:
| Q |
1 |
gcaagtttctgttgactatatgctggatggacgacacagtgatatgaaccttaaataggtcttcattcattaaaatctggcgaggaacccatgctacatt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24620951 |
gcaaatttctgttgactatatgctggatggacgacacaatgatatgaaccttaaataggtcttcattcatttaaatctggcgaggaacccatgctacatt |
24620852 |
T |
|
| Q |
101 |
tgacctatgtagccccacacatcaaattcaaggtccaacatacgacactaacgcacgtaattacattcacttacttctattttcatattttattactagt |
200 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24620851 |
tgacctatgtagccccatacatcaaattgaaggtccaacatacgacactgacgcacgtaattacattcacttacttctattttcatattttattactagt |
24620752 |
T |
|
| Q |
201 |
gttcacgtgtcttgtctatattggtacttcatc |
233 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| |
|
|
| T |
24620751 |
gttcacatgtcttgtctttattggtacttcatc |
24620719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 110
Target Start/End: Original strand, 47570090 - 47570194
Alignment:
| Q |
6 |
tttctgttgactatatgctggatggacgacacagtgatatgaaccttaaataggtcttcattcattaaaatctggcgaggaacccatgctacatttgacc |
105 |
Q |
| |
|
||||| ||||| || |||||||||||| |||| | ||||||||||| ||| |||||| || |||| ||||||||| |||| | || | |||||||||| |
|
|
| T |
47570090 |
tttcttttgaccatctgctggatggacagcacaataatatgaaccttgaatgggtctttatgcattgaaatctggcaaggagcacaagtaacatttgacc |
47570189 |
T |
|
| Q |
106 |
tatgt |
110 |
Q |
| |
|
||||| |
|
|
| T |
47570190 |
tatgt |
47570194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University