View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10865A_low_307 (Length: 243)

Name: NF10865A_low_307
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10865A_low_307
NF10865A_low_307
[»] chr2 (1 HSPs)
chr2 (22-225)||(40637799-40638004)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 225
Target Start/End: Complemental strand, 40638004 - 40637799
Alignment:
22 tcctttcccatctggcttccctttctcttccacctttttcttccccacaaattatttgtttttgttgtaattgaattgtttgtgttctggattttagaga 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40638004 tcctttcccatctggcttccctttctcttccacctttttcttccccacaaattatttgtttttgttgtaattgaattgtttgtgttctggattttagaga 40637905  T
122 tagagattccattttctatgatatattagg--nnnnnnnnnnnggggaaaatgatagattgagttgtagcttttaattgaaaacaaaaatgtaatcacac 219  Q
    ||||||||||| ||||||||||||||||||             ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||    
40637904 tagagattccactttctatgatatattaggtttttttttttttgggaaaaatgatagattgagttgtagattttaattgaaaacaaaaatgtaatcacac 40637805  T
220 aatatt 225  Q
    ||||||    
40637804 aatatt 40637799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University