View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_307 (Length: 243)
Name: NF10865A_low_307
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_307 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 225
Target Start/End: Complemental strand, 40638004 - 40637799
Alignment:
| Q |
22 |
tcctttcccatctggcttccctttctcttccacctttttcttccccacaaattatttgtttttgttgtaattgaattgtttgtgttctggattttagaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40638004 |
tcctttcccatctggcttccctttctcttccacctttttcttccccacaaattatttgtttttgttgtaattgaattgtttgtgttctggattttagaga |
40637905 |
T |
|
| Q |
122 |
tagagattccattttctatgatatattagg--nnnnnnnnnnnggggaaaatgatagattgagttgtagcttttaattgaaaacaaaaatgtaatcacac |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40637904 |
tagagattccactttctatgatatattaggtttttttttttttgggaaaaatgatagattgagttgtagattttaattgaaaacaaaaatgtaatcacac |
40637805 |
T |
|
| Q |
220 |
aatatt |
225 |
Q |
| |
|
|||||| |
|
|
| T |
40637804 |
aatatt |
40637799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University