View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_308 (Length: 243)
Name: NF10865A_low_308
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_308 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 43703339 - 43703564
Alignment:
| Q |
1 |
gattagtctttcaattgcatgcagagaatactttgg-ttta--aaaaagaaaacaattttataaacttatgttcatctaaaaccacctttatcgaacact |
97 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43703339 |
gattagtctttcaattgcatgcctggaatactttgggtttaccaaaaaaaaaacaattttataaacttatgtttatctaaaaccacctttatcgaacact |
43703438 |
T |
 |
| Q |
98 |
tgcccaaatgcacactctttttcgtattgataatgaattacttttgttggttcaaccacctacattgaggaatcaaaatactagttgagtttgtcttgtg |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703439 |
tgcccaaatgcacactttttttcgtattgataatgaattacttttgtt-gttcaaccatctacattgaggaatcaaaatactagttgagtttgtcttgtg |
43703537 |
T |
 |
| Q |
198 |
agattcttatcttgtgattggtccatc |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43703538 |
agattcttatcttgtgattggtccatc |
43703564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University