View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_311 (Length: 242)
Name: NF10865A_low_311
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_311 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 242
Target Start/End: Original strand, 34142215 - 34142448
Alignment:
| Q |
9 |
tggtgttctgaaaaccacaaatatcaatatgcaaaacatgttagcaacttagcatttgatcagatggaaaataacaagcattcaaaaatcattgaactag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142215 |
tggtgttctgaaaaccacaaatatcaatatgcaaaacatgttagcaacttagcatttgatcagatggaaaataacaagcattcaaaaatcattgaactag |
34142314 |
T |
|
| Q |
109 |
ctctactcatttgcaaccataatcttgctaccaaaaacccagtttgtgaggcaaaatcaattaattgtataaactatataataatgtataaacaagctca |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142315 |
ctctacgcatttgcaaccataatcttgctaccaaaaacccagtttgtgaggcaaaatcaattaattgtataaactatataataatgtataaacaagctca |
34142414 |
T |
|
| Q |
209 |
aagagggacggttaatttaatagtcattatgagt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34142415 |
aagagggacggttaatttaatagtcattatgagt |
34142448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University