View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_314 (Length: 241)
Name: NF10865A_low_314
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_314 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 46844976 - 46845191
Alignment:
| Q |
17 |
gaaatgaattaggggattgatgttggggttgttgtccacaattattatttttgttgtcattttgatggtgataaaaatgtatgacttgaacttgcattan |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844976 |
gaaatgaattaggggattgatgttggggtta--gtccacaattattatttttgttgtcattttgatggtgataaaaatgtatgacttgaacttgcattat |
46845073 |
T |
|
| Q |
117 |
nnnnnn--ataaaaagtactagtactctacattaataatgccataatcacgcttcacgcctataggagtaggacccatgacattatttgaagtagattct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46845074 |
ttttttttataaaaagtactagtactctacattaataatgccataatcacgcttcacgcctataggagtaggacccatgacattatttgaagtagattct |
46845173 |
T |
|
| Q |
215 |
tttactttgtatattgtt |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46845174 |
tttactttgtatattgtt |
46845191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University