View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_316 (Length: 241)
Name: NF10865A_low_316
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_316 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 48 - 211
Target Start/End: Complemental strand, 9457309 - 9457146
Alignment:
| Q |
48 |
gaaaatcaagattaattgtaatttataaacattttatctctcccctacacaaaacacaaacttgagatcggtaacaaaatgagtgttgagatttttatta |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457309 |
gaaaatcaagattaattgtaatttataaacattttatctctcccctacgcaaaacacaaacttgagatcggtaacaaaatgagtgttgagatttttatta |
9457210 |
T |
|
| Q |
148 |
ccgtattccaaaatggctatatgtgatttttattacaatctaatgatcatctatcaagtaaaca |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9457209 |
ccgtattccaaaacggctatatgtgatttttattacaatctaatgatcatctataaagtaaaca |
9457146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University