View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_329 (Length: 238)
Name: NF10865A_low_329
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_329 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 34988439 - 34988651
Alignment:
| Q |
15 |
atgaagaacaaatatttacaccttgacaggcttaatgctttatggattgtggattggtatggcagaccatacaacatggactttagaaaacaagaaacaa |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34988439 |
atgaagaacaaatatttacgccttgacaggcttaatgctttatggattttgaattggtatggcagaccatataacatggactttagaaaacaagaaacaa |
34988538 |
T |
|
| Q |
115 |
tatataggatgaggcannnnnnncattaattttttatcgtctagtcctacaacaagtctactacaatctaatctaccagccagttccaaccctcatgggt |
214 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
34988539 |
tatataggatgaggcatttttttcattcattttttatcgtctagtcctacaacaattctactacagtctaatctacaagccagttccaaccctcatgggt |
34988638 |
T |
|
| Q |
215 |
ttaccgacagcta |
227 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
34988639 |
ttaacgacagcta |
34988651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University