View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_332 (Length: 238)
Name: NF10865A_low_332
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_332 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 219
Target Start/End: Original strand, 37320305 - 37320502
Alignment:
| Q |
22 |
gagggagcctgtgtagggggacggtgattaggcctttgatatggattttgctgtggagggtatggatatgttgattgtggatatccatagttattttccc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320305 |
gagggagcctgtgtagggggacggtgattaggcctttgatatggattttgctgtggagggtatggatatgttgattgtggatatccatagttattttccc |
37320404 |
T |
|
| Q |
122 |
atgaagatgaagaagaaccaacagagccatatgatgttgatggtgatgatgaatttacatctctcctccgagacccttttgaactcttacctcccatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320405 |
atgaagatgaagaagaaccaacagagccatatgatgttgatggtgatgatgaatttacatctctcctccgagacccttttgaactcttacctcccatt |
37320502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University