View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_337 (Length: 236)
Name: NF10865A_low_337
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_337 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 43098844 - 43099076
Alignment:
| Q |
1 |
gagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagcagcttgcaaaatgcaaaatcatatagtactactgtcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43098844 |
gagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagctgcttgcaaaatgcaaaatcatatagtactaccgtcta |
43098943 |
T |
|
| Q |
101 |
aaacttgtatgtcaggtctagctcaccatttgatgacacttacattagtatatagttgaacatgcatttctataaaagtatactgtacaaatgcagtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098944 |
aaacttgtatgtcaggtctagctcaccatttgatgacacttacattag--tatagttgaacatgcatttctataaaagtatactgtacaaatgcagtttt |
43099041 |
T |
|
| Q |
201 |
ttaacaagaaatatatttgggtaaatgatcacttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099042 |
ttaacaagaaatatatttgggtaaatgatcacttt |
43099076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University