View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_379 (Length: 229)
Name: NF10865A_low_379
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_379 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 13245491 - 13245276
Alignment:
| Q |
1 |
gttcttgcagtattggaggaaaccaccaaaaaatttctgactgtcatttatccggtgtgtccttgatccttagaaggccgccaccattccttccttttcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13245491 |
gttcttgcagtattggaggaaaccaccaaaaaaattctgaatgtcatttatccggtgtgtccttgatccttagaaggccgccaaaattccttccttttcg |
13245392 |
T |
|
| Q |
101 |
acggctttttggccttagcagcggctgatgacagccagaaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaag |
200 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
13245391 |
acggctttttggccttaccagcggcttatgacagccagaaatacagttatttcttgtagtgatggtcaccctgtgtcactaaagttttattttgcgcaag |
13245292 |
T |
|
| Q |
201 |
agtttcatagcttata |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
13245291 |
agtttcatagcttata |
13245276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 13266638 - 13266567
Alignment:
| Q |
139 |
aaatacagttatttcttgtagtgatggtcaccatgtgtcactaaagttttattttgcgtaagagtttcatag |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13266638 |
aaatatagttatttcttgtagtgatggtcactctgtgtcactaaagttttattttgcgtaagagtttcatag |
13266567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University