View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_405 (Length: 224)
Name: NF10865A_low_405
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_405 |
 | |
|
| [»] scaffold0009 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 24 - 202
Target Start/End: Complemental strand, 40188 - 40010
Alignment:
| Q |
24 |
aacagagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcaca |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40188 |
aacacagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcaca |
40089 |
T |
|
| Q |
124 |
cacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40088 |
cacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgtcgttttgctgcttca |
40010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 24 - 200
Target Start/End: Complemental strand, 33561 - 33391
Alignment:
| Q |
24 |
aacagagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcaca |
123 |
Q |
| |
|
|||| ||||| || ||||||||| ||||||||||||| ||| | ||||| |||||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
33561 |
aacacagatcgagcgttttaagcaaaggaagatcaactgaacaacgagat------ggtacaattattctatccaatttgagaaccacaagtgtttcaca |
33468 |
T |
|
| Q |
124 |
cacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgctt |
200 |
Q |
| |
|
||||||||||||||| ||||| |||||| || ||||||||||||||||||||| || || ||| |||||||||||| |
|
|
| T |
33467 |
cacgaaaatggtaggcgacaaggtcacttctaccatgcatagatagagatcctcgaccccacgtcgttttgctgctt |
33391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 201
Target Start/End: Complemental strand, 21826 - 21734
Alignment:
| Q |
109 |
cacaagtgtttcacacacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttc |
201 |
Q |
| |
|
|||||||||| ||| |||||||||||||| ||||| |||||| ||||| | ||||||||||||||| || || ||| |||||||| |||| |
|
|
| T |
21826 |
cacaagtgttctacaaacgaaaatggtaggcgacaaggtcacttctaacaagtttagatagagatcctcgaccccacgtcgttttgcttcttc |
21734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 138
Target Start/End: Original strand, 19970209 - 19970313
Alignment:
| Q |
34 |
aagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcacacacgaaaatg |
133 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| | ||| |||||| | ||||| || ||| |||||| || ||||||||||||||||| ||||||| |
|
|
| T |
19970209 |
aagggttttgagcgaaggaagatcaacagaagaacgaaacatagttgttacatgtatgctaaacaatttcagaaccacaagtgtttcacagcagaaaatg |
19970308 |
T |
|
| Q |
134 |
gtagg |
138 |
Q |
| |
|
||||| |
|
|
| T |
19970309 |
gtagg |
19970313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University