View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10865A_low_408 (Length: 223)

Name: NF10865A_low_408
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10865A_low_408
NF10865A_low_408
[»] chr8 (1 HSPs)
chr8 (20-195)||(38124647-38124822)
[»] chr5 (1 HSPs)
chr5 (41-85)||(13510301-13510345)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 38124647 - 38124822
Alignment:
20 ctatggaatttaaataaattgctattggttcgtgatacgctgtttagaacaaagtgatgtcaaatagtagctatgaaactctgtagcttaatagagtttg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
38124647 ctatggaatttaaataaattgctattggttcgtgatacgctgtttagaacaaagtgatgtcaaatagtagctatgaaactctgtaacttaatagagtttg 38124746  T
120 aacaaactgctatattccacgatctacagttgaaaacacttttttctacttacacagctgaatttgtttttgtgtg 195  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
38124747 aacaaactgctatattccacgatctacacttgaaaacacttttttctacttacacagctgaatttgtttttgtgtg 38124822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 13510345 - 13510301
Alignment:
41 ctattggttcgtgatacgctgtttagaacaaagtgatgtcaaata 85  Q
    |||||| ||||||| ||||| ||||| ||||||||||||||||||    
13510345 ctattgtttcgtgaaacgctatttagtacaaagtgatgtcaaata 13510301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University