View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_417 (Length: 221)
Name: NF10865A_low_417
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_417 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 31441508 - 31441321
Alignment:
| Q |
20 |
ttttccgccatagtcttcatcaaaacacttcttgcataaaagcttccaatgactaatggctgtactgcaatcatcacaagagaaagcccccatgtgagca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31441508 |
ttttccgccatagtcttcatcaaaacacttcttgcataaaagcttccaatgactaatggctgtactgcaatcatcacaagagaaagcctccatgtgagca |
31441409 |
T |
 |
| Q |
120 |
caagtcctacagtgtaagcaaagatggatccaaagattgcttgagccagaagagacatccggtcgccaacgagtgaacggaccaagtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441408 |
caagtcctacagtgtaagcaaagatggatccaaagattgcttgagccagaagagacatccggtcgccaacgagtgaacggaccaagtt |
31441321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University