View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_418 (Length: 221)
Name: NF10865A_low_418
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_418 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 206
Target Start/End: Complemental strand, 22443590 - 22443397
Alignment:
| Q |
10 |
tgtcgaacaatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443590 |
tgtcgaaccatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta |
22443491 |
T |
 |
| Q |
110 |
cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgtttttattttaagttcttccgaagacacttttgctgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22443490 |
cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgttttttttttaag---ttccgaagacacttttgctgat |
22443397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University