View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_423 (Length: 220)
Name: NF10865A_low_423
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_423 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 220
Target Start/End: Original strand, 19190111 - 19190324
Alignment:
| Q |
7 |
cctccggtgttcctaccggacgaaaaaatggttattctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190111 |
cctccggtgttcctaccggacgaaaaaagggttattctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagag |
19190210 |
T |
 |
| Q |
107 |
tggttatggacgttatggtggtggtactacaggtggtggttacggtcttgataaccgatctaacagtggttatggaggtggacgttctggtggagctact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190211 |
tggttatggacgttatggtggtggtactacaggtggtggttacggtcttgataaccgatctaacagtggttatggaggtggacgttctggtggagctact |
19190310 |
T |
 |
| Q |
207 |
ggtgggggttatgg |
220 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
19190311 |
ggtggtggttatgg |
19190324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University