View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_426 (Length: 220)
Name: NF10865A_low_426
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_426 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 187
Target Start/End: Original strand, 5397000 - 5397163
Alignment:
| Q |
15 |
ctactaaaataaatataaaaacttatttaagcaattaaaattggtaaaactgtaaagggtatatatacacatagatacaatcaaggcgcacagatttaca |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
5397000 |
ctactaaaataaatataaaaatttatttaagcaattaaaattggtaaaattgtaaagggtatatat--acatagatacaatcaag--gcacagatttaca |
5397095 |
T |
 |
| Q |
115 |
aaactaactttttagcttttaatggatggtttataaattcgtacgctaaaaaatagacttgtgataacttctg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||| |
|
|
| T |
5397096 |
aaactaactttttagcttttaatggatggtttacga----gtacgct-aaaaatagacttgtgataacttctg |
5397163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University