View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_428 (Length: 218)
Name: NF10865A_low_428
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_428 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 3041972 - 3042152
Alignment:
| Q |
19 |
agttaatagtcaaatctggaagtatatggataataaagtctactgcagaccccatgcattttgttacttaactctattatctggctggtaaattattggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3041972 |
agttaatagtcaaatctggaagtatatggataataaagtctactgtagaccccatgcattttgttacttaactctattatctggctggtaaattaatggt |
3042071 |
T |
|
| Q |
119 |
agttagtaacgttgtcgttcagat-nnnnnnnnctttatgtatacatcataaattcatagtcatatccagaataatatagc |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3042072 |
agttagtaacgttgtcgttcagataaaaaaaaactttatgtatacatcataaattcatagtcatatccagaatattatagc |
3042152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University