View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_432 (Length: 215)
Name: NF10865A_low_432
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_432 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 23 - 190
Target Start/End: Complemental strand, 6358429 - 6358263
Alignment:
| Q |
23 |
atgtgtaaatccccataagcttaaccttgtgagtggtctgtaatccccatatcattatcaactaatttatgttttgaagcataaacctttggnnnnnnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358429 |
atgtgtaaatccccataagcttaaccttgtgagtggtctgtaatccccatatcattatcaactaatttatgttttgaagcataaacctttgg-aaaaaaa |
6358331 |
T |
|
| Q |
123 |
tctgcaatctctttaatattgatttctgtcgctcctcaatgtctcaagttcgattctccttaatgtct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6358330 |
tctgcaatctctttaatattgatttctgttgctcctcaatgtctcaagttcgattctcctcaatgtct |
6358263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University