View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_438 (Length: 212)
Name: NF10865A_low_438
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_438 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 44 - 188
Target Start/End: Original strand, 17503087 - 17503228
Alignment:
| Q |
44 |
cgcttccttttgggggattctcttcggcgcgaagacttttgtggcgagtctctcaacttcctcttgacacctttttgttagtcgctttagtgaaatggct |
143 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17503087 |
cgcttccttttgggggattctc---ggcgcgaagacttttgtggcgagtctctcaacttcctcttgtcacctttttgttagtcgctttagtgaaatggct |
17503183 |
T |
|
| Q |
144 |
gagctttccttttttattcaatttttcactagtgtctttcagctg |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17503184 |
gagctttccttttttattcaattcttcactagtgtctttcagctg |
17503228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University