View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_439 (Length: 212)
Name: NF10865A_low_439
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_439 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 193
Target Start/End: Complemental strand, 28587093 - 28586921
Alignment:
| Q |
21 |
gatctatacttgggaacatatggtaaacgtttaccttttcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587093 |
gatctatacttgggaacatatggtaaacgtttacctattcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtgt |
28586994 |
T |
 |
| Q |
121 |
atgacaccattagctttaatctactcatatattttaccaatctccccatatattctgtatccatatatattac |
193 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586993 |
atgacaccattaactttaatctactgatatattttaccaatctccccatatattctgtatccatatatattac |
28586921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University