View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_442 (Length: 211)
Name: NF10865A_low_442
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_442 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 82 - 207
Target Start/End: Original strand, 3722162 - 3722285
Alignment:
| Q |
82 |
ctgttaccattttccaagaaaaaaggtggtggggtttatggtcttgactagttgcaaaagtagagannnnnnngagttcttattaagaaagtgcttttta |
181 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
3722162 |
ctgttacccttttccaagaaaaaaggtggtggggtttatggtcttgactagttgcaaaagt--agatttttttgagttcttattaagaaagtgcttttta |
3722259 |
T |
|
| Q |
182 |
gggagaataatcatatgcaaattatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3722260 |
gggagaataatcatatgcaaattatg |
3722285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University