View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_448 (Length: 208)
Name: NF10865A_low_448
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_448 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 55 - 185
Target Start/End: Complemental strand, 3098921 - 3098791
Alignment:
| Q |
55 |
tgtgggtctctatggtaacaaaagtagccgaaaggaatgcaatgcatgaagagggattgtgaccgttgatgaatgtagtggtgggccatgtatgacatac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098921 |
tgtgggtctctatggtaacaaaagtagccgaaaggaatgcaatgcatgaagagggattgtgaccgttgatgaatgtagtggtgggccatgtatgacatac |
3098822 |
T |
 |
| Q |
155 |
tgaatggtggtgattgagttgtgagtgtaat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3098821 |
tgaatggtggtgattgagttgtgagtgtaat |
3098791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University