View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_449 (Length: 208)
Name: NF10865A_low_449
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_449 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 30877827 - 30878016
Alignment:
| Q |
19 |
atatcataaccttccatttccatagcaaagtgaaaagagaaatgaaaaaggagagttgtttgtggggaccaaacacaggagacaaccttggaaacaatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877827 |
atatcataaccttccatttccatagcaaagtgaaaagagaaatgaaaaaggagagttgtttgtggggaccaaacacaggagacaaccttggaaacaatgg |
30877926 |
T |
|
| Q |
119 |
aataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaataagtgacagtagat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30877927 |
aataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagat |
30878016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University