View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_45 (Length: 407)
Name: NF10865A_low_45
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 37 - 404
Target Start/End: Original strand, 39079370 - 39079739
Alignment:
| Q |
37 |
tcaaacctgggatgaaccggaagaatttca---ggtttgagttgtccggtgctataacaaggttagcaaccacannnnnnnnattgaacataaaccatag |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39079370 |
tcaaacctgggatgaaccggaagaatttcatcaggtttgagttgtccagtgctataacaaggttagcaaccacattttttt-attgaacataaaccatag |
39079468 |
T |
|
| Q |
134 |
tcacttaaccaatagatttattggttatgtcgatttgaataataacattttctcagttgaggatattgccgctagagacgagcttt-tttatgnnnnnnn |
232 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
39079469 |
tcacttaaccactagatttattggttatgtcgatttgaataataacattttcttagttgaggatattgccgctagagacgagctttgtttacgaaaaaaa |
39079568 |
T |
|
| Q |
233 |
ngtttagatgagttagattttggggttcatcagggtcagagcatatctcaatgctaaaaaacgtttatagaggtggttaccgatcatccaccaaagaagt |
332 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
39079569 |
c-tttagatgagttagactttggggctcatcagggtcagagcagatttcaatgctaaaatacgtttatagaggtggttaccgatcatccactaaagaggt |
39079667 |
T |
|
| Q |
333 |
cctgacatttataacaaaagttaaattcacagagaggtaaatcaatctcttatcgaccgagctaaccttcat |
404 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39079668 |
cctgacatttataacagaagttaaattcacaaacagataaatcaatctcttatcgaccgagctagccttcat |
39079739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University