View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_452 (Length: 207)
Name: NF10865A_low_452
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_452 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 6 - 194
Target Start/End: Original strand, 30025340 - 30025528
Alignment:
| Q |
6 |
agaaacaacttaaaacaaacaggacttggaactccaacagcaaacagaatccaagaaagtatataatgagaaaacaaatttgaatcaaaccacggtattg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30025340 |
agaaacaacttaaaacaaacaggacttggaactccaacaacaaacagaatccaagaaagtatataatgagaaaacaaatttgaatcaaacgacggtattg |
30025439 |
T |
 |
| Q |
106 |
actagtagaataaaaaggagaaagtagggattcatagctttttacacttcaatgatactgtgtcaactgtcaagaccttggtcgtttat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30025440 |
actagtagaataaaaaggagaaagtagggattcatagctttttacacttcaatgatactgtgtcaactgtgaagaccttggtagtttat |
30025528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University