View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_455 (Length: 206)
Name: NF10865A_low_455
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_455 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 37 - 187
Target Start/End: Complemental strand, 6416497 - 6416347
Alignment:
| Q |
37 |
gggccttgcaattgcacttgcggtgaattcaatgttgccacattgttccccgccactactgtcacgaaactctttgtttgcttcttgaggattgatagct |
136 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| |||| ||| |
|
|
| T |
6416497 |
gggcgttgcaattgcacttgcggtgaattcaatgttgccacattgttccccgccactactgtcacgatacttgttgtttgcttcgtgaggactgatggct |
6416398 |
T |
 |
| Q |
137 |
actgttgcatccgctaagtttaaggtttggaatgaacaagacgacatatgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6416397 |
actgttgcatccgctaagtttaaggtttagaatgaacaagacgacatatgt |
6416347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University