View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10865A_low_455 (Length: 206)

Name: NF10865A_low_455
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10865A_low_455
NF10865A_low_455
[»] chr7 (1 HSPs)
chr7 (37-187)||(6416347-6416497)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 37 - 187
Target Start/End: Complemental strand, 6416497 - 6416347
Alignment:
37 gggccttgcaattgcacttgcggtgaattcaatgttgccacattgttccccgccactactgtcacgaaactctttgtttgcttcttgaggattgatagct 136  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||||||| |||||| |||| |||    
6416497 gggcgttgcaattgcacttgcggtgaattcaatgttgccacattgttccccgccactactgtcacgatacttgttgtttgcttcgtgaggactgatggct 6416398  T
137 actgttgcatccgctaagtttaaggtttggaatgaacaagacgacatatgt 187  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||    
6416397 actgttgcatccgctaagtttaaggtttagaatgaacaagacgacatatgt 6416347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University