View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_86 (Length: 356)
Name: NF10865A_low_86
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 265 - 350
Target Start/End: Original strand, 2041085 - 2041170
Alignment:
| Q |
265 |
tgtatacctatctagttattcagttcgtctttagacaaatattgaataagaaatttagcatttaaattataattctgccaacttac |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2041085 |
tgtatacctatctagttattcagttcgtctttagacaaatattgaataagaaatttagcatttaaattataattctgccaacttac |
2041170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 40 - 106
Target Start/End: Original strand, 22659350 - 22659415
Alignment:
| Q |
40 |
tataagtagttaaatgaaggtctaattttaaaaaacataatcttgtcaaactatcttacacaatcgt |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| | |||||||||||| ||||||||||| |
|
|
| T |
22659350 |
tataagtagttaaatgaaagtctaattttaaaatacatact-gtgtcaaactatcatacacaatcgt |
22659415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University