View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865_high_12 (Length: 240)
Name: NF10865_high_12
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865_high_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 38422206 - 38422428
Alignment:
| Q |
18 |
ttaacatactctttagcccacattgatattgatggttggtatgattaatcttgcgtcattaatctttcaaacagaaatgtttacaaggaactcacttgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422206 |
ttaacatactctttagcccacattgatattgatggttggtatgattaatcttgcgtcattaatctttcaaacagaaatgtttacaaggaactcacttgag |
38422305 |
T |
 |
| Q |
118 |
acaatgttgtcttcagtaagatctgctaataatggttggtatgattgtggattacactttttgcttcaattcttgttgtgatagcaaatgcaattgtagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422306 |
acaatgttgtcttcagtaagatctgctaataatggttggtatgattgtggattacactttttgcttcaattcttgttgtgatagcaaatgcaattgtagg |
38422405 |
T |
 |
| Q |
218 |
tgttgtttggtgggtatgataat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38422406 |
tgttgtttggtgggtatgataat |
38422428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 74 - 165
Target Start/End: Original strand, 38412353 - 38412448
Alignment:
| Q |
74 |
cattaatctttcaaacagaaatgtttacaagga--actcacttgagacaatgttgtcttcagtaagatctgctaat---aatggttggtatgattgt |
165 |
Q |
| |
|
||||||||||||||||| |||||||| ||| || ||||||||| |||||||||||||| |||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
38412353 |
cattaatctttcaaacaaaaatgtttgcaatgaacactcacttg-gacaatgttgtcttgagtaagatctactaatgtcaatggttggaatgattgt |
38412448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University