View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10865_high_13 (Length: 238)

Name: NF10865_high_13
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10865_high_13
NF10865_high_13
[»] chr2 (1 HSPs)
chr2 (1-223)||(2923704-2923926)
[»] chr4 (2 HSPs)
chr4 (53-223)||(36127139-36127309)
chr4 (51-136)||(16009871-16009956)


Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2923926 - 2923704
Alignment:
1 tacattgtcatatagtttgtctcatttgatgtgtccttttgctcttttcgtataggtttgataaaaggataacagcttttgccgaagacaagtttcaaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2923926 tacattgtcatatagtttgtctcatttgatgtgtccttttgctcttttcgtataggtttgataaaaggataacagcttttgccgaagacaagtttcaaag 2923827  T
101 agatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaagaaatttccactaaagagctgaaaaatggaggaaagattactacaatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2923826 agatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaagaaatttccactaaagagctgaaaaatggaggaaagattactacaatt 2923727  T
201 ccatatggaatggctgtctggtc 223  Q
    |||||||||||||||||||||||    
2923726 ccatatggaatggctgtctggtc 2923704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 53 - 223
Target Start/End: Original strand, 36127139 - 36127309
Alignment:
53 taggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaa 152  Q
    ||||||||| ||||| |||||| | ||||| |||||||||||  |||||||||| |||||||||||||||||||||||||||   ||||||  ||  | |    
36127139 taggtttgacaaaagaataacaacctttgctgaagacaagttcaaaagagatggtattgatgtgaaaacaggatccatggttacaaaggtatctgacaga 36127238  T
153 gaaatttccactaaagagctgaaaaatggaggaaagattactacaattccatatggaatggctgtctggtc 223  Q
    |||||| ||||||||||  |||||||||||||| | |||||||| ||||||||||||||||||||||||||    
36127239 gaaattaccactaaagaaatgaaaaatggaggagaaattactactattccatatggaatggctgtctggtc 36127309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 136
Target Start/End: Complemental strand, 16009956 - 16009871
Alignment:
51 tataggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattgatgtgaaaacaggatccatggttgt 136  Q
    ||||||||||| || || |||||||  ||||| ||||| |||||  |||||||||| ||||||||||||   ||||| ||||||||    
16009956 tataggtttgacaagagaataacagaatttgctgaagaaaagttcaaaagagatggaattgatgtgaaattgggatcaatggttgt 16009871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University