View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865_high_13 (Length: 238)
Name: NF10865_high_13
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2923926 - 2923704
Alignment:
| Q |
1 |
tacattgtcatatagtttgtctcatttgatgtgtccttttgctcttttcgtataggtttgataaaaggataacagcttttgccgaagacaagtttcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2923926 |
tacattgtcatatagtttgtctcatttgatgtgtccttttgctcttttcgtataggtttgataaaaggataacagcttttgccgaagacaagtttcaaag |
2923827 |
T |
 |
| Q |
101 |
agatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaagaaatttccactaaagagctgaaaaatggaggaaagattactacaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2923826 |
agatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaagaaatttccactaaagagctgaaaaatggaggaaagattactacaatt |
2923727 |
T |
 |
| Q |
201 |
ccatatggaatggctgtctggtc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2923726 |
ccatatggaatggctgtctggtc |
2923704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 53 - 223
Target Start/End: Original strand, 36127139 - 36127309
Alignment:
| Q |
53 |
taggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaa |
152 |
Q |
| |
|
||||||||| ||||| |||||| | ||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| || | | |
|
|
| T |
36127139 |
taggtttgacaaaagaataacaacctttgctgaagacaagttcaaaagagatggtattgatgtgaaaacaggatccatggttacaaaggtatctgacaga |
36127238 |
T |
 |
| Q |
153 |
gaaatttccactaaagagctgaaaaatggaggaaagattactacaattccatatggaatggctgtctggtc |
223 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
36127239 |
gaaattaccactaaagaaatgaaaaatggaggagaaattactactattccatatggaatggctgtctggtc |
36127309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 136
Target Start/End: Complemental strand, 16009956 - 16009871
Alignment:
| Q |
51 |
tataggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattgatgtgaaaacaggatccatggttgt |
136 |
Q |
| |
|
||||||||||| || || ||||||| ||||| ||||| ||||| |||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
16009956 |
tataggtttgacaagagaataacagaatttgctgaagaaaagttcaaaagagatggaattgatgtgaaattgggatcaatggttgt |
16009871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University