View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865_low_17 (Length: 241)
Name: NF10865_low_17
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 27801916 - 27801977
Alignment:
| Q |
7 |
aaccttctaacatgtcttctgaattttggaattgcactcttgatttaaagaggacaaaagat |
68 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27801916 |
aaccttctaatgcgtcttctgaattttggaattgcactcttgatttaaaggggacaaaagat |
27801977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University