View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865_low_21 (Length: 233)
Name: NF10865_low_21
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 34924678 - 34924883
Alignment:
| Q |
11 |
gagatgaaggtgaatgagattttgacagagggagatttgaagaggaaaagtttggttaatggagttgttaaagaggttaatggaggagagattagggaga |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34924678 |
gagatcaaggtgaatgagattttgacagagggagatttgaagaggaaaagtttggttaatggagttgttaaagaggttaatggaggagagattagggaga |
34924777 |
T |
|
| Q |
111 |
cgacagagaattgaggctgtgaatggaccttgaatgttggtgttggagagattaagttcagttacggtggtgtttgtggagtcacagcgtacaccgtacc |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34924778 |
cgacagaggattgaggctgtgaatggaccttgaatgttggtgttggagagattaagttcagttacggtggtgtttgtggagtcacagcgtacaccgtacc |
34924877 |
T |
|
| Q |
211 |
agttac |
216 |
Q |
| |
|
|||||| |
|
|
| T |
34924878 |
agttac |
34924883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 119 - 195
Target Start/End: Original strand, 10893060 - 10893136
Alignment:
| Q |
119 |
aattgaggctgtgaatggaccttgaatgttggtgttggagagattaagttcagttacggtggtgtttgtggagtcac |
195 |
Q |
| |
|
|||||| | ||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
10893060 |
aattgatgttgtgaatggaccttgaatgtttgcgttggagaggttaagttcagttacggtggtgttggtggagtcac |
10893136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University