View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865_low_5 (Length: 401)
Name: NF10865_low_5
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 113 - 391
Target Start/End: Complemental strand, 44999350 - 44999076
Alignment:
| Q |
113 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacatttctttattta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44999350 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacattt----attta |
44999255 |
T |
|
| Q |
213 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999254 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
44999155 |
T |
|
| Q |
313 |
gtgtgcctctctatgatactcttggtaatgaaataagaaattgtccatacatttacttcatcctcccctgttttctctg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999154 |
gtgtgcctctctatgatactcttggtaataatataagaaattgtccatacatttacttcatcctcccctgttttctctg |
44999076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University