View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865_low_9 (Length: 303)
Name: NF10865_low_9
Description: NF10865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 14150921 - 14150646
Alignment:
| Q |
14 |
caaaggagatttagaaggaggnnnnnnntgattccagatgatctgaggtgatcaagagaacgacatccgatgagctctgctcaggagaataagaacatat |
113 |
Q |
| |
|
|||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14150921 |
caaaagagatttagaaggaggaaaaaaatgattctagatgatctgaggtgatcaagagaacgacgtccgatgagctctgctcaggagaataagaacatac |
14150822 |
T |
 |
| Q |
114 |
cacatctaaaatgaaaaatcagaagtaacaagtagatgataggatgactccacttgagaagcatagaagacaccagttgtgctgctaaagtcttcaataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14150821 |
cacatctaaaatgaaaaatcagaagtaacaagtagatgataggatgactccacttgagaagcatagaagacaccagttgtgctgctaaagtcttcaataa |
14150722 |
T |
 |
| Q |
214 |
ccctccgtctgaagagatttagtcgggtgggcaccctatc---aagtagctgaattaccttattgggggtccaaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
14150721 |
ccctccgtctgaagagatttagtcgggtgggcaccctatcctgaagtagctgaattaccttattggggttccaaat |
14150646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University